Combine FASTA

Merge multiple FASTA sequences into a single continuous sequence for batch analysis and codon usage studies.

Combination Statistics

Sequences Combined
0
Total Length
0
Average Length
0
Output Format
Plain

What is Combine FASTA?

Combine FASTA is a bioinformatics tool that merges multiple FASTA sequence records into a single continuous sequence. This is essential when analyzing collections of sequences through programs that only accept single sequence inputs, such as codon usage calculators.

How to Use This Combine FASTA Tool

Quick guide to combine sequences:

  1. Paste multiple FASTA sequences with headers
  2. Combined sequence appears automatically
  3. View statistics and download results

When to Use

This tool is useful when you need to:

  • Analyze codon usage for multiple genes together
  • Create consensus sequences from multiple records
  • Prepare batch sequences for single-input programs

Example Input

Sample FASTA input:

>Gene1
ATCGATCGATCG
>Gene2
GCTAGCTAGCTA

Try with your own sequences or use the Example button.

Example Output

Combined output (no headers):

ATCGATCGATCGGCTAGCTAGCTA

All sequences merged into one continuous string.

FAQ

Q: Does this preserve FASTA headers?
A: No, headers are removed. Only sequences are combined.

Q: What's the maximum input size?
A: The tool can handle sequences up to 500 million characters.