Merge multiple FASTA sequences into a single continuous sequence for batch analysis and codon usage studies.
Combine FASTA is a bioinformatics tool that merges multiple FASTA sequence records into a single continuous sequence. This is essential when analyzing collections of sequences through programs that only accept single sequence inputs, such as codon usage calculators.
Quick guide to combine sequences:
This tool is useful when you need to:
Sample FASTA input:
>Gene1
ATCGATCGATCG
>Gene2
GCTAGCTAGCTATry with your own sequences or use the Example button.
Combined output (no headers):
ATCGATCGATCGGCTAGCTAGCTAAll sequences merged into one continuous string.
Q: Does this preserve FASTA headers?
A: No, headers are removed. Only sequences are combined.
Q: What's the maximum input size?
A: The tool can handle sequences up to 500 million characters.