CpG Depletion Tool

Remove or reduce CpG dinucleotides from coding sequences using synonymous mutations to reduce immunogenicity

CpG Statistics

What is CpG Depletion?

CpG depletion is the process of removing cytosine-guanine dinucleotides (CpG) from DNA sequences through synonymous mutations. CpG motifs can trigger immune responses, making CpG depletion essential for gene therapy, vaccine development, and therapeutic protein production.

How to Use This Tool

Deplete CpG dinucleotides in three steps:

  1. Paste your coding DNA sequence
  2. Tool automatically removes CpG with silent mutations
  3. Download optimized sequence with statistics

When to Use

This tool is useful when you need to:

  • Reduce immunogenicity in gene therapy vectors
  • Optimize sequences for vaccine development
  • Design mRNA therapeutics with lower innate immune activation

Example Input

Coding sequence with CpG sites:

ATGCGTAAACGATCGAAAGCACCG

CpG dinucleotides are highlighted: CCG, CGA, CGA, CCG

Example Output

CpG-depleted sequence:

ATGAGGAAACGTTCTAAATCTCCA

Same protein, fewer CpG sites using synonymous codons.

FAQ

Q: Will this change my protein sequence?
A: No, only synonymous mutations are used to maintain the same amino acid sequence.

Q: Can all CpG sites be removed?
A: Most can, but some codons have limited synonymous options.