Remove or reduce CpG dinucleotides from coding sequences using synonymous mutations to reduce immunogenicity
CpG depletion is the process of removing cytosine-guanine dinucleotides (CpG) from DNA sequences through synonymous mutations. CpG motifs can trigger immune responses, making CpG depletion essential for gene therapy, vaccine development, and therapeutic protein production.
Deplete CpG dinucleotides in three steps:
This tool is useful when you need to:
Coding sequence with CpG sites:
ATGCGTAAACGATCGAAAGCACCGCpG dinucleotides are highlighted: CCG, CGA, CGA, CCG
CpG-depleted sequence:
ATGAGGAAACGTTCTAAATCTCCASame protein, fewer CpG sites using synonymous codons.
Q: Will this change my protein sequence?
A: No, only synonymous mutations are used to maintain the same amino acid sequence.
Q: Can all CpG sites be removed?
A: Most can, but some codons have limited synonymous options.