CpG Parameter Calculator

Calculate CpG Observed/Expected ratio, GC content, and dinucleotide frequencies for DNA sequences

What is CpG Parameter Calculator?

The CpG Parameter Calculator quantifies CpG dinucleotide content in DNA sequences. It calculates the CpG Observed/Expected ratio (Obs/Exp), which is crucial for identifying CpG islands - genomic regions often found near gene promoters where CpG dinucleotides occur more frequently than expected.

How to Use This Tool

Quick guide:

  1. Paste your DNA sequence (FASTA or plain text)
  2. Results calculate automatically
  3. View CpG Obs/Exp ratio, GC content, and dinucleotide frequencies
  4. Download or copy the detailed analysis

When to Use

This tool is essential for:

  • Identifying potential CpG islands in genomic sequences
  • Analyzing promoter regions for methylation studies
  • Evaluating sequence composition for gene expression studies
  • Calculating expected vs observed CpG frequencies

Example Input

Sample DNA sequence:

CGCGCGATCGATCGCGCGCGATATCGCGCGCG

This CpG-rich sequence demonstrates high Obs/Exp ratio.

Example Output

Expected results:

CpG Obs/Exp: 1.15 GC Content: 61.76% CpG Count: 10 Sequence Length: 34 bp

Values > 0.6 suggest potential CpG island.

FAQ

Q: What is a good CpG Obs/Exp ratio?
A: Ratios > 0.6 indicate potential CpG islands. Typical genomic DNA has ~0.2-0.4.

Q: What does the calculation mean?
A: It compares observed CpG frequency to expected frequency based on individual C and G content.