DNA/RNA Length Calculator

Calculate sequence length, molecular weight, GC content, and base composition for DNA and RNA sequences

Sequence Statistics

What is DNA/RNA Length Calculator?

This DNA/RNA length calculator counts nucleotides in DNA and RNA sequences and calculates additional important properties including molecular weight, GC content, and base composition. It's essential for primer design, cloning, PCR, and molecular biology experiments where accurate sequence measurements are needed.

How to Use This Calculator

  1. Paste your DNA or RNA sequence (FASTA or plain text)
  2. Results appear automatically with length, MW, and composition
  3. View detailed statistics below the output
  4. Download or copy results for your records

When to Use

This calculator is useful when you need to:

  • Count nucleotides in DNA or RNA sequences
  • Calculate molecular weight for copy number calculations
  • Determine GC content for primer design
  • Analyze base composition for sequence optimization
  • Process multiple sequences in batch

Example Input

DNA sequence example:

ATCGATCGATCGGGCCAAATTTGCG

RNA sequence example:

AUCGAUCGAUCGGGCCAAAUUUGCG

Example Output

Results include:

Length: 25 bp
MW: 7,684.08 Da
GC Content: 52.00%
A: 8 (32.00%)
T: 4 (16.00%)

FAQ

Q: Does this calculate molecular weight?
A: Yes, it calculates MW for both single-stranded and double-stranded DNA/RNA.

Q: Can I analyze multiple sequences?
A: Yes, paste multiple sequences in FASTA format for batch analysis.