FASTA Cleaner

Strip FASTA headers and extract clean sequence data. Remove header lines from FASTA files for downstream analysis.

What is FASTA Cleaner?

FASTA Cleaner is a tool that strips FASTA format headers and extracts only the sequence data. This is useful when you need clean sequences without the descriptive header lines for specific applications or downstream tools that only accept plain sequence data.

How to Use This FASTA Cleaner

Quick guide to clean your sequences:

  1. Paste your FASTA formatted sequences
  2. Toggle options to join sequences or remove spaces
  3. Clean sequences appear automatically
  4. Download or copy the cleaned output

When to Use

This tool is useful when you need to:

  • Remove FASTA headers before analysis
  • Extract only sequence data from FASTA files
  • Prepare sequences for tools that don't accept FASTA format
  • Combine multiple sequences into one continuous string
  • Clean up sequence formatting for downstream processing

Example Input

FASTA format with headers:

>gene1 description ATCGATCGATCG >gene2 description GCTAGCTAGCTA

Headers starting with ">" will be removed.

Example Output

Clean sequences without headers:

ATCGATCGATCG GCTAGCTAGCTA

Or joined: ATCGATCGATCGGCTAGCTAGCTA

FAQ

Q: Does this tool handle multiple sequences?
A: Yes, it processes all sequences and can either keep them separate or join them into one.

Q: Can I remove all formatting?
A: Yes, enable "Remove spaces and line breaks" to get a continuous sequence string.