Strip FASTA headers and extract clean sequence data. Remove header lines from FASTA files for downstream analysis.
FASTA Cleaner is a tool that strips FASTA format headers and extracts only the sequence data. This is useful when you need clean sequences without the descriptive header lines for specific applications or downstream tools that only accept plain sequence data.
Quick guide to clean your sequences:
This tool is useful when you need to:
FASTA format with headers:
>gene1 description
ATCGATCGATCG
>gene2 description
GCTAGCTAGCTAHeaders starting with ">" will be removed.
Clean sequences without headers:
ATCGATCGATCG
GCTAGCTAGCTAOr joined: ATCGATCGATCGGCTAGCTAGCTA
Q: Does this tool handle multiple sequences?
A: Yes, it processes all sequences and can either keep them separate or join them into one.
Q: Can I remove all formatting?
A: Yes, enable "Remove spaces and line breaks" to get a continuous sequence string.