FASTQ to FASTA Converter

Convert FASTQ sequencing files to FASTA format by removing quality scores while preserving sequence information

What is FASTQ to FASTA Conversion?

FASTQ to FASTA conversion removes quality scores from sequencing data while preserving sequence information. FASTQ format contains 4 lines per read (header, sequence, plus line, quality scores), while FASTA format contains 2 lines (header, sequence). This conversion is essential for tools that don't require quality information.

How to Use This Converter

Quick conversion guide:

  1. Paste FASTQ data or upload .fastq/.fq file
  2. Conversion happens automatically
  3. View statistics showing sequences processed
  4. Download FASTA output or copy to clipboard

When to Use FASTQ to FASTA

This tool is useful when you need to:

  • Prepare NGS data for BLAST searches
  • Convert reads for assembly programs
  • Remove quality scores to reduce file size
  • Use sequence data in FASTA-only tools
  • Extract sequences from Illumina/PacBio data

FASTQ Format Example

Standard FASTQ format (4 lines per sequence):

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCG
+
!''*((((***+))%%%++)(%%%%)

Quality scores use ASCII characters (! = lowest quality).

FASTA Format Output

Converted FASTA format (2 lines per sequence):

>SEQ_ID
GATTTGGGGTTCAAAGCAGTATCG

Header changes from @ to >, quality scores removed.

FAQ

Q: Does this tool handle paired-end reads?
A: Yes, it converts all sequences in the input. Keep R1 and R2 files separate.

Q: What happens to quality scores?
A: Quality scores are removed. If you need them later, keep the original FASTQ file.

Q: Can I convert FASTA back to FASTQ?
A: Yes, but you'll need to assign default quality scores as original scores are lost.