Convert FASTQ sequencing files to FASTA format by removing quality scores while preserving sequence information
FASTQ to FASTA conversion removes quality scores from sequencing data while preserving sequence information. FASTQ format contains 4 lines per read (header, sequence, plus line, quality scores), while FASTA format contains 2 lines (header, sequence). This conversion is essential for tools that don't require quality information.
Quick conversion guide:
This tool is useful when you need to:
Standard FASTQ format (4 lines per sequence):
@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCG
+
!''*((((***+))%%%++)(%%%%) Quality scores use ASCII characters (! = lowest quality).
Converted FASTA format (2 lines per sequence):
>SEQ_ID
GATTTGGGGTTCAAAGCAGTATCG Header changes from @ to >, quality scores removed.
Q: Does this tool handle paired-end reads?
A: Yes, it converts all sequences in the input. Keep R1 and R2 files separate.
Q: What happens to quality scores?
A: Quality scores are removed. If you need them later, keep the original FASTQ file.
Q: Can I convert FASTA back to FASTQ?
A: Yes, but you'll need to assign default quality scores as original scores are lost.