Search for DNA sequences with mismatches. Find similar sequences, potential restriction sites, and mutation targets.
Fuzzy Search DNA is a sequence matching tool that finds DNA patterns with allowed mismatches. Unlike exact matching, it identifies similar sequences that differ by a specified number of nucleotides, essential for finding mutations, polymorphisms, and degenerate primer sites.
Quick guide to find similar sequences:
This tool is useful when you need to:
Search pattern with 1 mismatch allowed:
Pattern: GATC
Sequence: ATCGATCGGTCCATCGATCGFinds: GATC, GGTC, CATC (1 mismatch each)
Results show match positions and differences:
Position 4: GATC (exact match)
Position 9: GGTC (1 mismatch at position 2)
Position 13: CATC (1 mismatch at position 1)Mismatches are highlighted for easy identification.
Q: What is the maximum number of mismatches?
A: You can allow up to 10 mismatches, though 1-3 is most common.
Q: Does it handle IUPAC ambiguity codes?
A: Currently supports standard DNA bases (A, T, C, G). IUPAC codes are treated as mismatches.