Fuzzy Search DNA

Search for DNA sequences with mismatches. Find similar sequences, potential restriction sites, and mutation targets.

Max Mismatches 1
Case Insensitive

Analysis Results

Total Matches

0

Unique Positions

0

Pattern Length

0

What is Fuzzy Search DNA?

Fuzzy Search DNA is a sequence matching tool that finds DNA patterns with allowed mismatches. Unlike exact matching, it identifies similar sequences that differ by a specified number of nucleotides, essential for finding mutations, polymorphisms, and degenerate primer sites.

How to Use This Fuzzy Search Tool

Quick guide to find similar sequences:

  1. Enter your search pattern (e.g., ATCG)
  2. Set maximum allowed mismatches
  3. Paste or upload DNA sequences to search
  4. View matches with positions and mismatches highlighted

When to Use

This tool is useful when you need to:

  • Find sequences with SNPs or mutations
  • Locate degenerate primer binding sites
  • Identify conserved motifs with variations
  • Search for restriction sites with mismatches

Example Input

Search pattern with 1 mismatch allowed:

Pattern: GATC
Sequence: ATCGATCGGTCCATCGATCG

Finds: GATC, GGTC, CATC (1 mismatch each)

Example Output

Results show match positions and differences:

Position 4: GATC (exact match)
Position 9: GGTC (1 mismatch at position 2)
Position 13: CATC (1 mismatch at position 1)

Mismatches are highlighted for easy identification.

FAQ

Q: What is the maximum number of mismatches?
A: You can allow up to 10 mismatches, though 1-3 is most common.

Q: Does it handle IUPAC ambiguity codes?
A: Currently supports standard DNA bases (A, T, C, G). IUPAC codes are treated as mismatches.