GenBank to FASTA

Convert GenBank format files to FASTA format by extracting sequences from GenBank entries

What is GenBank to FASTA?

GenBank to FASTA converter extracts DNA, RNA, or protein sequences from GenBank format files and converts them to FASTA format. This tool parses GenBank entries to extract the sequence data from the ORIGIN section and creates proper FASTA headers from the LOCUS information.

How to Use This GenBank to FASTA Converter

Convert GenBank files to FASTA in three simple steps:

  1. Paste your GenBank format data or upload a .gb file
  2. Results appear automatically in FASTA format
  3. Download or copy the converted sequences

When to Use

This tool is useful when you need to:

  • Convert GenBank files downloaded from NCBI to FASTA format
  • Extract sequence data for use in other bioinformatics tools
  • Prepare sequences for alignment or analysis software
  • Remove annotations and keep only sequence information

Example Input

Sample GenBank format:

LOCUS AF123456 500 bp DNA linear BCT 01-JAN-2000
DEFINITION Example sequence
ORIGIN
1 atggcaactg ctgaagattt ggctgaaatg gtagctaaac tggctgattt
51 ggataacctg gtagctaaac tggtagctaa actggctgat ttggataac
//

Try with your own GenBank file or use the Example button.

Example Output

Converted FASTA format:

>AF123456
ATGGCAACTGCTGAAGATTTGGCTGAAATGGTAGCTAAACTGGCTGATTT
GGATAACCTGGTAGCTAAACTGGTAGCTAAACTGGCTGATTTGGATAAC

Clean FASTA format ready for analysis.

FAQ

Q: Does this tool handle multiple GenBank entries?
A: Yes, it processes multiple GenBank records in a single file.

Q: What file formats are supported?
A: GenBank (.gb, .gbk, .genbank) and plain text files.

Q: Are annotations preserved?
A: No, only the sequence data is extracted for FASTA format.