Add or remove line breaks at specified intervals. Format sequences for different display requirements or file formats.
The Sequence Line Break Tool formats DNA, RNA, and protein sequences by adding or removing line breaks. This tool helps you adjust sequence display formats for different requirements, such as FASTA formatting (typically 60-80 characters per line) or creating continuous single-line sequences for analysis tools.
Quick guide to format your sequences:
This tool is useful when you need to:
Long sequence without breaks:
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGOr broken sequence to reformat.
Formatted with 60 characters per line:
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGOr all breaks removed for continuous sequence.
Q: What's the standard FASTA line length?
A: Most FASTA files use 60 or 80 characters per line. This tool defaults to 60.
Q: Does it preserve FASTA headers?
A: Yes, header lines (starting with >) are preserved and not reformatted.