Sequence Line Break Tool

Add or remove line breaks at specified intervals. Format sequences for different display requirements or file formats.

characters

What is the Line Break Tool?

The Sequence Line Break Tool formats DNA, RNA, and protein sequences by adding or removing line breaks. This tool helps you adjust sequence display formats for different requirements, such as FASTA formatting (typically 60-80 characters per line) or creating continuous single-line sequences for analysis tools.

How to Use This Tool

Quick guide to format your sequences:

  1. Paste your sequences in any format
  2. Choose to add breaks (set interval) or remove all breaks
  3. Results appear automatically as you type
  4. Download or copy the formatted output

When to Use

This tool is useful when you need to:

  • Format sequences to FASTA standard (60 characters per line)
  • Remove all line breaks for analysis tools
  • Adjust sequence display for publications or presentations
  • Reformat sequences to match specific file format requirements
  • Make long sequences easier to read with regular line breaks

Example Input

Long sequence without breaks:

ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG

Or broken sequence to reformat.

Example Output

Formatted with 60 characters per line:

ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG ATCGATCG

Or all breaks removed for continuous sequence.

FAQ

Q: What's the standard FASTA line length?
A: Most FASTA files use 60 or 80 characters per line. This tool defaults to 60.

Q: Does it preserve FASTA headers?
A: Yes, header lines (starting with >) are preserved and not reformatted.