Mutate for Digest

Find silent mutations to introduce or remove restriction enzyme recognition sites in coding sequences

What is Mutate for Digest?

A tool to identify positions in coding DNA sequences where silent (synonymous) mutations can introduce or remove restriction enzyme recognition sites. These mutations don't change the amino acid sequence, making them perfect for diagnostic restriction digests in molecular cloning and site-directed mutagenesis.

How to Use This Tool

Quick guide to find silent mutations:

  1. Select target restriction enzyme from dropdown
  2. Paste your coding DNA sequence (in-frame)
  3. View suggested silent mutation positions
  4. Copy or download the mutation suggestions

When to Use

This tool is essential for:

  • Creating diagnostic restriction sites for screening clones
  • Removing unwanted restriction sites before cloning
  • Designing site-directed mutagenesis primers
  • Planning restriction-based verification strategies

Example Input

Coding DNA sequence (in-frame):

ATGGCCAAGCTGGAAGTCGACCTGATCAAGAAGTAA

Select enzyme: EcoRI (GAATTC)

Example Output

Silent mutation suggestions:

Position 12-17: AGG → GAA creates EcoRI site
Silent mutation: Arg remains Arg

Shows position, change, and preserved amino acid.

FAQ

Q: What are silent mutations?
A: Synonymous codon changes that don't alter the protein sequence due to genetic code degeneracy.

Q: Why must sequences be in-frame?
A: To ensure mutations preserve the correct reading frame and protein sequence.