Oligo Calculator

Calculate molecular weight, melting temperature, GC content, and extinction coefficient for DNA/RNA oligonucleotides.

Oligonucleotide Analysis

What is an Oligo Calculator?

An oligonucleotide calculator is a specialized tool for analyzing short DNA or RNA sequences. It calculates molecular weight, melting temperature, GC content, and extinction coefficient - essential parameters for primer design, PCR optimization, and molecular biology applications.

How to Use This Oligo Calculator

Quick guide to analyze your oligonucleotides:

  1. Enter your oligonucleotide sequence (DNA or RNA)
  2. Select sequence type and adjust salt concentration
  3. View comprehensive analysis results automatically
  4. Copy or download the detailed calculations

When to Use

This oligo calculator is essential for:

  • PCR primer design and validation
  • qPCR probe optimization
  • Oligonucleotide synthesis planning
  • Melting temperature prediction
  • Concentration calculations from OD260 measurements

Example Input

Sample PCR primer sequence:

GCTAGCTAGCTAGCTAGCTAG

Use the Example button to load a 20-mer primer sequence.

Example Output

Comprehensive analysis including:

MW: 6,223.1 g/mol GC%: 60.0% Tm (Wallace): 56.4°C ε260: 198,400 M⁻¹cm⁻¹

Results include multiple Tm calculation methods and conversion factors.

FAQ

Q: What Tm calculation methods are used?
A: Basic (short oligos), Wallace rule, and nearest-neighbor thermodynamics for accuracy.

Q: How does salt concentration affect Tm?
A: Higher salt concentrations stabilize duplexes, increasing melting temperature.

Q: Can I calculate concentration from OD260?
A: Yes, enter your OD260 reading for automatic concentration calculation.