ORF Finder

Find open reading frames in DNA sequences by identifying start (ATG) and stop codons across all six reading frames.

ORF Search Parameters

ATG
GTG
CTG
TTG
Show ORF visualization map

What is ORF Finder?

An ORF (Open Reading Frame) Finder identifies potential protein-coding regions in DNA sequences by locating start codons (ATG) and stop codons (TAA, TAG, TGA) across all six possible reading frames.

How to Use This ORF Finder

Quick guide to find ORFs:

  1. Paste your DNA sequence
  2. ORFs are found automatically
  3. Review results showing all frames

When to Use

This tool is useful when you need to:

  • Identify potential genes in genomic DNA
  • Find coding sequences in unknown DNA
  • Predict protein-coding regions

Example Input

Sample DNA with ORF:

ATGGCTAGCAAATAAGGATCCATAG

Contains ATG start and TAG stop codon.

Example Output

Shows ORFs in all 6 frames:

Frame +1: Position 1-24 (24 bp) Start: ATG | Stop: TAG Protein: MASKLGS

Each ORF shows position, length, and translation.

FAQ

Q: What frames are checked?
A: All 6 frames (3 forward, 3 reverse).

Q: What's the minimum ORF length?
A: Shows all ORFs with start and stop codons.