PCR Products Calculator

Predict PCR amplification products from DNA templates and primers. Identify potential amplicons, their sizes, and annealing positions.

What is PCR Products Calculator?

A PCR (Polymerase Chain Reaction) products calculator predicts amplification outcomes by finding where primers anneal to template DNA and calculating the resulting product sizes. Essential for primer design and PCR troubleshooting.

How to Use This Tool

  1. Paste your DNA template sequence
  2. Enter forward and reverse primers (5' to 3')
  3. View predicted PCR products with sizes and positions
  4. Copy or download results

When to Use

This tool is useful when you need to:

  • Predict PCR product sizes before lab work
  • Verify primer annealing sites on templates
  • Troubleshoot unexpected PCR results
  • Design primers for specific amplicon sizes

Example Input

Template:

ATCGATCGATCGTAGCTAGCTAGCTACGATCGATCGATCG

Primers: ATCGATCG (forward) and CGATCGAT (reverse)

Example Output

Expected output format:

Product 1: 250 bp (Position 10-260)
Forward: ATCGATCG at position 10
Reverse: CGATCGAT at position 260

FAQ

Q: Does this support degenerate primers?
A: Yes, IUPAC ambiguous nucleotide codes are supported.

Q: Can I use multiple templates?
A: Yes, paste multiple sequences and each will be analyzed.