PCR Primer Designer

Design optimal PCR primers with Tm calculation, GC content analysis, and specificity checks

Primer Design Parameters

Primer Length 20 bp
Product Size 500 bp
Optimal Tm 60°C

Primer Analysis

What is PCR Primer Designer?

PCR Primer Designer is a tool that automatically generates optimal primer pairs for polymerase chain reaction (PCR) amplification. It analyzes DNA sequences to find primer pairs with appropriate melting temperatures, GC content, and minimal secondary structures.

How to Use This PCR Primer Designer

Design your primers in three simple steps:

  1. Paste your target DNA sequence
  2. Adjust parameters (length, Tm, product size)
  3. Review designed primer pairs and stats

When to Use

This tool is essential when you need to:

  • Design primers for PCR amplification
  • Clone genes or DNA fragments
  • Perform site-directed mutagenesis
  • Validate sequencing results
  • Create primers for qPCR experiments

Example Input

Sample target sequence:

ATGGCTAGCGATCGATCGATCGATCGATCGCTAGCTAGCTAGCTGACTGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC

Try with your own sequence or use the Example button.

Example Output

Designed primer pair:

Forward Primer: ATGGCTAGCGATCGATCGAT Position: 1-20 Tm: 59.8°C GC: 50.0% Reverse Primer: GATCGATCGATCGATCGATC Position: 481-500 Tm: 58.2°C GC: 50.0% Product Size: 500 bp

Multiple primer pairs ranked by quality.

FAQ

Q: What Tm calculation method is used?
A: Basic Tm = 4(G+C) + 2(A+T) for primers ≤14bp, salt-adjusted for longer primers.

Q: How are primer pairs selected?
A: Primers are scored based on Tm difference, GC content, self-complementarity, and 3' stability.