Range Extractor DNA

Extract specific DNA subsequences using position ranges. Support for arithmetic expressions and keywords like 'start', 'end', 'center'.

Enter positions or ranges separated by commas. Use '..' for ranges. Keywords: start, end, center, length

What is Range Extractor DNA?

Range Extractor DNA is a powerful tool for extracting specific subsequences from DNA sequences using position information. It supports complex range expressions, arithmetic operations, and keywords for flexible sequence extraction.

How to Use This Range Extractor

Extract DNA subsequences in seconds:

  1. Paste your DNA sequence (FASTA or plain text)
  2. Enter position ranges (e.g., "1..100, 200..300")
  3. Select output format and strand
  4. Results appear automatically

When to Use

This tool is essential when you need to:

  • Extract specific gene regions or features
  • Isolate promoter or regulatory sequences
  • Get subsequences for primer design
  • Extract flanking regions around features

Example Input

Sample DNA sequence with range specification:

Sequence: ATCGATCGATCGATCGATCG
Ranges: 1..5, 10..15, (end-2)..end

Try the Example button for a demo.

Example Output

Extracted subsequences:

>Range_1_5
ATCGA
>Range_10_15
TCGATC
>Range_18_20
TCG

Multiple output formats available.

FAQ

Q: What range expressions are supported?
A: Use '..' for ranges, keywords like 'start', 'end', 'center', 'length', and arithmetic expressions like '(end-10)..end'.

Q: Can I extract complement strand?
A: Yes, select "Complement strand" from the Strand dropdown to get the complement of extracted regions.