Extract specific DNA subsequences using position ranges. Support for arithmetic expressions and keywords like 'start', 'end', 'center'.
Range Extractor DNA is a powerful tool for extracting specific subsequences from DNA sequences using position information. It supports complex range expressions, arithmetic operations, and keywords for flexible sequence extraction.
Extract DNA subsequences in seconds:
This tool is essential when you need to:
Sample DNA sequence with range specification:
Sequence: ATCGATCGATCGATCGATCG
Ranges: 1..5, 10..15, (end-2)..end Try the Example button for a demo.
Extracted subsequences:
>Range_1_5
ATCGA
>Range_10_15
TCGATC
>Range_18_20
TCG Multiple output formats available.
Q: What range expressions are supported?
A: Use '..' for ranges, keywords like 'start', 'end', 'center', 'length', and arithmetic expressions like '(end-10)..end'.
Q: Can I extract complement strand?
A: Yes, select "Complement strand" from the Strand dropdown to get the complement of extracted regions.