Find the best reading frame for DNA sequences. Display all three forward frames, highlight stop codons, and identify the longest ORF.
A reading frame is one of three ways to divide a DNA sequence into codons (triplets). The correct reading frame determines which amino acids are encoded. Finding the right frame is essential for accurate protein translation and ORF identification.
Find the best reading frame in three steps:
This tool is useful when you need to:
DNA sequence (any length):
ATGTCCAAAGGTGAACTGCAGTool will show all 3 reading frames.
Three reading frames with translations:
Frame +1: MSKGELQ Frame +2: CPKVNC* Frame +3: VPRVMStop codons highlighted, best frame marked.
Q: What is the "best" reading frame?
A: The frame with the longest ORF (open reading frame) without stop codons.
Q: Do you show reverse frames?
A: This tool shows forward frames only. Use ORF Finder for all 6 frames.