Restriction Site Finder

Find all restriction enzyme recognition sites in DNA sequences. Show cut positions, fragment sizes, and compatible ends for cloning.

Select Restriction Enzymes

Restriction Sites Found

What are Restriction Sites?

Restriction sites are specific DNA sequences recognized by restriction enzymes (endonucleases). These enzymes cut DNA at precise locations, essential for molecular cloning, DNA analysis, and genetic engineering.

How to Use This Tool

Find restriction sites in three steps:

  1. Paste your DNA sequence
  2. Select restriction enzymes to search for
  3. View cut positions and fragment sizes

When to Use

This tool is useful when you need to:

  • Plan cloning strategies and restriction digests
  • Identify cut sites for subcloning
  • Check for unwanted restriction sites in constructs

Example Input

DNA sequence with multiple sites:

GAATTCGGATCCAAGCTTCTGCAG

Contains EcoRI, BamHI, HindIII, and PstI sites.

Example Output

Found sites with positions:

EcoRI: Position 1 (GAATTC) BamHI: Position 7 (GGATCC) HindIII: Position 13 (AAGCTT)

FAQ

Q: Are recognition sequences case-sensitive?
A: No, the tool accepts both uppercase and lowercase sequences.

Q: Can I search for custom enzymes?
A: Currently supports 30+ common restriction enzymes used in molecular biology.