Sequence Chunker

Split long DNA or RNA sequences into smaller chunks for synthesis, primer walking, or analysis

What is Sequence Chunker?

Sequence Chunker is a tool that splits long DNA or RNA sequences into smaller fragments of specified size. This is essential for gene synthesis orders (which typically have length limits), primer walking strategies, or when analyzing specific regions of long sequences. Each chunk is numbered for easy reference and tracking.

How to Use This Sequence Chunker

Quick guide to split your sequences:

  1. Set your desired chunk size (default 50 bp)
  2. Paste your DNA or RNA sequence
  3. Results appear automatically with numbered chunks
  4. Download or copy the chunked output

When to Use

This tool is useful when you need to:

  • Order gene synthesis (providers have length limits)
  • Plan primer walking for sequencing long inserts
  • Break sequences into manageable fragments for analysis
  • Create overlapping fragments for assembly strategies
  • Split sequences for PCR amplification in smaller pieces

Example Input

Sample long sequence (150 bp):

ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG

Chunk size: 50 bp

Example Output

Chunked output (3 fragments):

> Chunk 1 (1-50) ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG > Chunk 2 (51-100) ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG > Chunk 3 (101-150) ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG

FAQ

Q: What's the optimal chunk size for gene synthesis?
A: Most providers accept 200-1000 bp, but check with your specific vendor. Smaller chunks (50-100 bp) are useful for primer design.

Q: Does this handle FASTA format?
A: Yes, FASTA headers are preserved in the output.

Q: What happens if sequence length isn't divisible by chunk size?
A: The last chunk will contain the remaining bases (shorter than specified size).