Sequence Formatter

Format DNA/RNA sequences in readable blocks with custom spacing, line breaks, and numbering for publications

Formatting Options

Show line numbers
Remove all spaces (continuous)
Keep FASTA headers

What is Sequence Formatting?

Sequence formatting organizes DNA, RNA, or protein sequences into readable blocks with consistent spacing and line breaks. Standard formatting uses 10 bases per block with 60 bases per line, making sequences easier to read, reference specific positions, and present in publications or presentations.

How to Use This Formatter

Quick formatting guide:

  1. Paste sequence or upload FASTA file
  2. Set bases per block (default: 10)
  3. Set bases per line (default: 60)
  4. Choose separator and case format
  5. Toggle line numbers if needed
  6. Copy or download formatted output

When to Use Sequence Formatter

This tool is useful when you need to:

  • Prepare sequences for publication figures
  • Create readable alignment references
  • Format sequences for presentations
  • Add line numbers for position tracking
  • Standardize sequence display format
  • Convert between different spacing styles

Example Input

Unformatted sequence:

ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG

Long continuous sequence without breaks

Example Output

Formatted with 10 bases per block, 60 per line:

ATCGATCGAT CGATCGATCG ATCGATCGAT CGATCGATCG ATCGATCGAT CGATCGATCG
ATCGATCGAT CGATCGATCG ATCGATCGAT CG

Easy to read and reference specific positions

FAQ

Q: What is the standard formatting for publications?
A: Most journals use 10 bases per block with 60 bases per line, sometimes with line numbers.

Q: Can I format multiple sequences at once?
A: Yes, paste FASTA format with headers and toggle "Keep FASTA headers" on.

Q: How do line numbers work?
A: Line numbers show the position of the first base on each line for easy reference.