Sequence Trimmer

Trim adapters, remove low-quality bases, and clean sequences for downstream NGS analysis

Trimming Options

Remove sequences containing N's
Convert to uppercase
Trim adapters (auto-detect Illumina/Nextera)

What is Sequence Trimming?

Sequence trimming removes unwanted bases from sequencing reads to improve data quality. This includes removing adapter sequences added during library preparation, trimming low-quality ends, removing primers, and filtering sequences that don't meet quality standards. Essential preprocessing step for NGS analysis.

How to Use This Trimmer

Follow these steps:

  1. Paste sequences or upload FASTA file
  2. Set trimming parameters (start, end, length)
  3. Optional: Add adapter sequence to remove
  4. Toggle options (remove N's, auto-detect adapters)
  5. View statistics and download results

When to Use Sequence Trimmer

This tool is useful when you need to:

  • Remove Illumina/Nextera adapter sequences
  • Trim primers from amplicon sequencing
  • Remove low-quality ends from reads
  • Filter sequences by minimum length
  • Clean data before assembly or mapping
  • Remove N's from uncertain base calls

Example Input

Sequences with adapters and low-quality ends:

>Read1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTGAAA
>Read2
NNNGATCGTAGCTAGCTAGCTAGCTAGNNN

Adapter: AGATCGGAAG, Low quality N's present

Example Output

Cleaned sequences after trimming:

>Read1
GCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTGAAA

Read2 removed (contains N's), adapter trimmed from Read1.

FAQ

Q: What adapters are auto-detected?
A: Illumina TruSeq (AGATCGGAAG), Nextera (CTGTCTCTTATACACATCT), and common primers.

Q: Should I trim before or after quality filtering?
A: Typically trim adapters first, then filter by quality and length.

Q: What is a good minimum length?
A: For short reads: 20-30bp. For long reads: 50-100bp. Depends on downstream analysis.