Shuffle DNA

Randomly shuffle DNA sequences while preserving nucleotide composition. Perfect for generating control sequences for statistical analysis.

What is Shuffle DNA?

Shuffle DNA randomly rearranges nucleotides in a DNA sequence while maintaining the exact same composition (number of A, T, G, C). This creates randomized control sequences for statistical significance testing.

How to Use This Shuffle DNA Tool

Generate shuffled sequences instantly:

  1. Paste or upload your DNA sequence
  2. Sequence is automatically shuffled
  3. Click "Shuffle Again" for new randomization
  4. Copy or download shuffled result

When to Use

This tool is useful when you need to:

  • Create null hypothesis controls
  • Test significance of sequence patterns
  • Generate random sequences with specific composition
  • Validate motif finding algorithms

Example Input

Original sequence:

ATGCGATCGTAGCTAGCTAGCATGC

Try with the Example button.

Example Output

Shuffled (same composition):

GCATGTAGCTCGATAGCGTACGATC

Same A, T, G, C counts, different order.

FAQ

Q: Is the composition always preserved?
A: Yes, nucleotide counts remain exactly the same.

Q: Can I shuffle multiple sequences?
A: Yes, FASTA format with multiple sequences is supported.