Tm Calculator

Calculate melting temperature for oligonucleotides and PCR primers with multiple calculation methods

Calculation Parameters

Na+ concentration 50 mM
Oligonucleotide concentration 250 nM

What is Tm Calculator?

The Tm Calculator calculates the melting temperature of oligonucleotides and PCR primers using established thermodynamic models. Essential for primer design, PCR optimization, and molecular cloning applications.

How to Use This Tm Calculator

Quick guide to calculate Tm:

  1. Enter primer sequences (one per line)
  2. Adjust salt and primer concentrations
  3. View calculated Tm and GC content
  4. Download results for PCR planning

When to Use

This tool is essential for:

  • PCR primer design and validation
  • qPCR assay development
  • Hybridization experiment planning
  • Molecular cloning primer selection
  • Temperature gradient optimization

Example Input

Sample primer sequences:

ATCGATCGATCGATCG GCTAGCTAGCTAGCTA AAAAACCCCCGGGGGTTTTT

Try with your own primers or use the Example button.

Example Output

Tm calculation results:

Sequence: ATCGATCGATCGATCG Length: 16 bp GC Content: 50.0% Tm (Basic): 52.0°C Tm (Salt-adjusted): 54.2°C

Results include multiple calculation methods.

FAQ

Q: Which Tm calculation method is most accurate?
A: Salt-adjusted method accounts for buffer conditions and is more accurate for PCR applications.

Q: What primer length is optimal?
A: 18-25 nucleotides typically provide good specificity and Tm values of 55-65°C.